|
Risk Factors Associated with a Clipboard Romance by |
![]() |
Background
Cumulative evidence indicates that being smitten by Cupid's arrows is a strong risk factor for chronic pain, trauma, premature aging, and death. But no studies have been conducted to determine how these risks specifically affect two people named Bob and Teena.
Method
The cohort of Bob and Teena was tracked carefully over a follow-period of one and a half minutes. The relationship was evaluated using the Barbara Cartland criteria for emotive effusion, on the Harlequin scale of passion.
Content
Bob grasps Teena passionately in his arms, but the results are not statistically significant.Conclusion
While the preliminary data appears promising, more study is needed to determine if Bob and Teena are fated for each other.Archives of Clinical Passion, 2001, 4(18):3-7.
"Bob, I promise to love you forever, until the stars burn from the skies [95% CI, 0.3-14.8 yrs]."
"Teena, if you really loved me, why did you sleep with all the men in the control group? [n=24]"
"I had to make sure our love was real, Bob. I had to make sure it was randomized, double-blinded, and placebo-controlled."
Bob swept Teena into his arms. She could feel the heat rising inside her like a Bunsen burner beneath a beaker. Her heart rate variability (HRV) surged, the change quickly approaching statistical significance [P < .06]. Her long, trembling fingers released the clipboard, letting it free-fall to the floor at an acceleration velocity of 10 m/s/s.
"Oh, Bob. I don't want us to be just a sloppy correlation, a mere chance event. I want this relationship to pass the full rigors of peer review. Won't you come and meet my coworkers in the field?"
Bob hesitated. He stared deep into her dilating visual apparati. She felt the look dissect her very being, as if, in that single glance, he had instantaneously performed an automated mapping of her entire genome:
AAGGTTCCTCTGAACGGTATAAGGTTCCTCTGAACGGTATAAGGTTCCTCTGAACGGTATAAGGTT
CCTCTGAACG
GTATAAGGTTCCTCTGAACGGTATAAGGTTCCTCTGAACGGTATAAGGTTCCTCTGAACGGTATAA
GGTTCCTCTG
AACGGTATAAGGTTCCTCTGAACGGTATAAGGTTCCTCTGAACGGTATAAGGTTCCTCTGAACGG
TATAAGGTTCC
TCTGAACGGTATAAGGTTCCTCTGAACGGTAT . . .
"Teena, if it works for us, who cares what the others think?"
Teena pulled apart from him.
"Oh, Bob. I know it all seems good and well, in vitro. But the others may perceive statistical errors we've missed. Their criticism will help us adjust our relative risks, and make our relationship hold up under conditional logistic regression."
"Teena, you're naive. Those reviewers have their own hidden agendas, and they may simply want to prevent the dissemination of our novel and exciting preliminary findings."
Teena felt a pang of fear well up inside her adrenocortex, skewing the normal circadian secretion pattern of cortisol. This adrenal dysfunction, she knew, could be clearly represented on a non-numerical graph.
"I'm confused, Bob. Some days I think we're meant for each other, but other days it seems like we have absolutely nothing in common . . . and the coefficient of variation for these feelings just seems so high [mean CV <.90]."
"Are you implying that everything . . . everything we've shared . . . is just a statistical outlier?" Bob gasped.
Teena remained silent for awhile. Then she slowly shook her head, her fiery, flowing curled red locks tucked safely beneath a crisp and crinkled baby-blue head cover to prevent external contamination.
"There are just so many confounding factors to control for," she said softly.
"Teena, what are you wearing under that white lab coat?" Bob's voice was more than two standard deviations below normal.
"Nothing. Nothing but street clothes, Bob."
Despite herself, Teena felt intoxicated with the lingering aroma of formaldehyde and other chemical reagents. She felt the product of his XY chromosome rub against her, like an urgent, insistent . . .
"Test tube!" She suddenly exclaimed. "Oh dear, it's my fault, I got sidetracked, I wasn't paying attention, and now the specimen . . . it's irretrievably degraded . . ."
"Oh Teena, I'm sorry," Bob said.
"Never mind," she said, vaguely trying to defuse the importance of the experimental loss. "If it's true love, and if it's meant to be, our results will be reproducible . . ."
Patrick Runkel is a medical/science writer with a diverse background in language arts, music, and mathematics.
Cary Barnhard grew up in New Jersey, where his senior class voted him "most unique." He maintains that honor is a polite way of being voted "most likely to need therapy." After a few misadventures in the music industry, he started pretending to be a graphic artist. Eventually it became the truth.


Mate Choice Turns Cognitive - a review of research into mate-choice in humans. Trends in Cognitive Sciences, 1998, 2:5:190-198. Full text available from BioMedNet.
Facial Attractiveness - a review of research examining the question of whether attractiveness reflects phenotypic condition. From Trends in Cognitive Sciences, 1999, 3:12:452-460. Full text available from BioMedNet.
Magnetic Resonance Imaging of Male and Female Genitals During Coitus and Female Sexual Arousal - Pek van Andel and his colleagues took home an Ig Nobel Prize in medicine for this research.
The Science of Love - a short summary of research from ABCNews.com.
Science Connection - "the network for single people interested in science or nature" is one place to go if you think having a scientific partner (or a partner who is interested in science) might be right for you. There is an annual membership fee.
Related HMS Beagle articles: